Preview

Гематология и трансфузиология

Расширенный поиск

БОЛЕЗНЬ ВИЛЛЕБРАНДА: СОПОСТАВЛЕНИЕ КЛИНИЧЕСКИХ, КОАГУЛОГИЧЕСКИХ И МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКИХ ДАННЫХ

https://doi.org/10.35754/0234-5730-2019-64-3-246-255

Полный текст:

Аннотация

Введение. Болезнь Виллебранда (БВ), являющаяся одной из самых распространенных коагулопатий, имеет сложный характер наследования, который, в зависимости от типа заболевания, может быть как доминантным, так и рецессивным.

Цель настоящей работы — сопоставление клинических, коагулогических и молекулярно-генетических данных, полученных при обследовании больных различными типами БВ. Материалы и методы: экзоны гена vWF для 16 больных БВ секвенировали по методу Сэнгера.

Результаты. Всего было выявлено 12 различных мутаций, одна из которых (Pro2527His) ранее в мировой популяции не встречалась. Наиболее распространенной оказалась микроделеция c.2435delC, являющаяся мажорной во многих странах Европы. Она встретилась у 9 больных, 6 из которых имели самый тяжелый рецессивный 3-й тип заболевания (3 гомозиготы). Еще у 2 больных это нарушение сочеталось с миссенс-мутацией Thr791Met, что позволило диагностировать у них достаточно редкий рецессивный вариант БВ — 2N. В целом, данные молекулярно-генетического анализа соответствовали результатам дифференциальной диагностики типа БВ, основанной на клинической картине заболевания и коагулогических характеристиках. Только в одном случае у больной с предполагаемым 1-м типом БВ была выявлена мутация Arg1374Cys, характерная для типа 2 (A/M). Большая часть мутаций была обнаружена в экзонах 18 (преимущественно это была делеция c.2435delC) и 28, что делает эти экзоны наиболее перспективными при поиске мутаций.

Заключение. Начинать поиск мутаций в гене vWF целесообразно с экзонов 18 и 28. Полученные данные могут послужить основой для создания экономичного алгоритма поиска мутаций в гене vWF у отечественных больных БВ. 

Для цитирования:


Чернецкая Д.М., Лихачева Е.А., Пшеничникова О.С., Сурин В.Л., Зозуля Н.И. БОЛЕЗНЬ ВИЛЛЕБРАНДА: СОПОСТАВЛЕНИЕ КЛИНИЧЕСКИХ, КОАГУЛОГИЧЕСКИХ И МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКИХ ДАННЫХ. Гематология и трансфузиология. 2019;64(3):246-255. https://doi.org/10.35754/0234-5730-2019-64-3-246-255

For citation:


Chernetskaya D.M., Likhacheva E.A., Pshenichnikova O.S., Surin V.L., Zozulya N.I. VON WILLEBRAND DISEASE: CLINICAL, COAGULOGICAL, MOLECULAR AND GENETIC DATA COMPARISON. Russian journal of hematology and transfusiology. 2019;64(3):246-255. (In Russ.) https://doi.org/10.35754/0234-5730-2019-64-3-246-255

Введение

Болезнь Виллебранда (БВ) относится к наиболее распространенным наследственным коагулопатиям. По результатам эпидемиологического исследова­ния [1], частота встречаемости индивидов со снижен­ной плазменной активностью фактора Виллебранда в различных популяциях может достигать 1 %, хотя по оценкам специализированных медицинских цен­тров, основанным на данных комплексного анализа, включающего коагулогические и генетические тесты, частота встречаемости БВ не превышает 1:10 000 [2]. Заболевание вызывается дефицитом или структур­но-функциональными нарушениями фактора фон Виллебранда (vWF) — крупного мультимерного гли­копротеина, играющего важную роль в поддержании гемостаза. Разные домены этого белка взаимодейству­ют с фактором свертывания крови VIII (FVIII), гли­копротеинами на поверхности тромбоцитов и коллаге­ном [3]. Ген vWF локализован в прителомерной области короткого плеча 12-й хромосомы (12p13.31), занимает на ней около 178 тпн и состоит из 52 экзонов [4]. Суще­ствует также частичная копия этого гена — непроцессированный псевдоген на длинном плече хромосомы 22 (22q11—13), включающий экзоны 23—34 и имеющий гомологию с геном 97 % [5].

Различают первый, второй и третий типы БВ, при­чем для второго типа выделяют также четыре подтипа заболевания (2A, 2B, 2M и 2N) [6]. Общая и диффе­ренциальная (по типам) диагностика БВ осуществля­ется на основе определения клинического, лаборатор­ного и молекулярного фенотипов. Геморрагический синдром преимущественно по микроциркуляторному типу варьирует в широких пределах — от легких, малосимптомных, до тяжелых клинических форм. Фенотипы БВ во многом определяются генетическим фоном и зависят от типа мутации, степени экспрессии гена, а также остаточной функциональной активности гликопротеина. В этой связи внутри каждого типа БВ могут наблюдаться субпопуляции с тяжелыми или бо­лее легкими проявлениями [7]. При тяжелых формах, преимущественно 3-м типе БВ, помимо кровоточиво­сти из слизистых оболочек, могут возникать гемартро­зы. Однако данные о частоте артропатии при БВ не­многочисленны [8—10].

При коагулогическом исследовании оценивают ан­тиген vWF (vWF:Ag), активность FVIII (FVIII:C) (она снижается, если снижена активность vWF) и ристоцетин-кофакторную активность (vWF:RCo). Для уточ­нения типа заболевания исследуют агрегацию тром­боцитов, индуцированную ристоцетином, и профиль мультимеров vWF с помощью электрофореза в агароз­ном геле.

Наиболее распространена БВ 1-го типа, она состав­ляет от 55 до 70 % всех диагностированных случаев. Чаще всего при этом варианте заболевания наблю­дается снижение количества vWF без нарушения его функций. Самая редкая (1—3 %) и тяжелая форма БВ 3-го типа характеризуется практически полным от­сутствием vWF. Поскольку одной из функций vWF является связывание с FVIII и его защита от прежде­временного протеолиза, у больных БВ 3-го типа на­блюдается не только отсутствие vWF, но и очень низ­кое значение FVIII:C.

При БВ 2-го типа наблюдаются качественные дефек­ты vWF, которые у большинства больных выражают­ся в непропорциональном снижении vWF:RCo (или vWF:CB) по отношению к vWF:Ag. Для диагностики подтипов БВ типа 2 используют анализ структуры мультимеров vWF.

У больных БВ типа 2A наблюдаются изолирован­ный дефицит высокомолекулярных мультимеров vWF и сниженная vWF- зависимая адгезия тромбоцитов.

Тип 2B БВ включает различные варианты качествен­ного дефекта vWF, выражающиеся в его повышенном сродстве к рецептору гликопротеину Ib-тромбоцитов.

Тип 2М БВ включает различные варианты качест­венного дефекта vWF, выражающиеся в снижении vWF-зависимой адгезии тромбоцитов без изолиро­ванного дефицита высокомолекулярных мультимеров vWF. Функциональный дефект обусловлен мутация­ми, в результате которых происходит нарушение свя­зывания vWF с тромбоцитами или субэндотелием.

Тип 2N БВ (Нормандия) был впервые описан в 1990 г. [11]. У больных с БВ типа 2N имеется дефект vWF в ме­сте связывания с В результате этого не может образоваться комплекс vWF—FVIII. Данный вариант БВ определяют с помощью теста связывания vWF с FVIII [12]. У многих больных с данным вариантом БВ ранее диагностировали гемофилию А легкой или умеренной степени тяжести (FVIII:C составляет 5—22 %) [13].

Анализ мутаций в гене vWF позволяет не только вери­фицировать диагноз БВ, но и способствует уточнению типа заболевания, поскольку генные дефекты, соот­ветствующие различным типам и подтипам БВ, раз­личаются по своему характеру и локализации [14, 15]. Так, для БВ 1-го и 3-го типов характерны «тяжелые» мутации, приводящие к полному отсутствию функци­онального белка (нонсенс-мутации, frameshift-мута­ции, мутации в канонических динуклеотидах сайтов сплайсинга) и рассеянные по всему пространству гена, тогда как при 2-м типе (кроме рецессивных вариантов 2A и 2N) встречаются только приводящие к аминокис­лотным заменам миссенс-мутации, причем преимуще­ственно в самом большом экзоне 28 гена vWF (1399 пн), кодирующем домены А1 и А2, отвечающие за мульти- меризацию белка. Варианты БВ 3-го типа и подтипа 2N наследуются рецессивно, и, следовательно, для их проявления необходимо наличие мутаций в обоих аллелях гена vWF. Для подтипов 2В и 2М характерно доминантное наследование, то есть достаточно нару­шения только в одном из аллелей. Тип 1 и подтип 2A в генетическом плане более сложны и могут иметь оба варианта наследования [14].

Цель настоящей работы — сопоставление клиниче­ских, коагулогических и молекулярно-генетических данных, полученных при обследовании российских больных различными типами БВ.

Больные и методы

Больные

В исследование было включено 15 больных с установ­ленным диагнозом БВ и один больной с генетически не подтвердившимся первичным диагнозом гемофилия А. Критериями диагноза БВ были: клинические про­явления геморрагического синдрома, семейный анам­нез и снижение vWF:RCo. Диагностический алгоритм выполнялся в соответствии с Национальными клини­ческими рекомендациями Российской Федерации [16]. Характеристика больных: 4 больных 1-м типом БВ (25 %), 5 больных 2-м типом БВ (31 %), 6 больных 3-м типом БВ (37 %), один больной, у которого первоначаль­но был установлен диагнозом легкой формы гемофилии А (7 %); средний возраст (лет) 47 (21—71), средняя масса тела (кг) 72 (48—90); пол м/ж 5/11. Больные старше 40 лет составили 69 % (11/16). Проводилась оценка клинико­анамнестических данных, результатов исследования свертывающей системы крови и генеалогических дан­ных. Тяжелое проявление болезни наблюдалось у 50 % больных, средняя частота геморрагических эпизодов по микроциркуляторному типу была 3—4 раза в месяц. У одной больной 3-м типом БВ в анамнезе было тоталь­ное эндопротезирование коленного сустава. Коморбид- ные состояния у 11 больных старшей возрастной груп­пы: заболевания желудочно-кишечного тракта были у 27 % (3), онкологические заболевания — у 9 % (1), аутоиммунные заболевания — у 9 % (1), кардиальная патология — у 27 % (3).

С гемостатической целью применялись концентра­ты FVIII, сбалансированные по vWF в соотношении FVIII/vWF (500/1200); FVIII/vWF (450/400). Шесть больных получали лечение в профилактическом ре­жиме 40 МЕ/кг массы тела два раза в неделю. Де­сяти больным лечение проводилось концентратами FVIII+vWF по необходимости в стандартных терапев­тических дозах.

Коагулогические тесты

Определение FVIII:C, vWF:RCo выполнялось од­ностадийным клоттинговым методом; vWF-Ag — методом иммуноферментного анализа; агрегацию тромбоцитов, индуцированную ристоцетином, опре­деляли оптическим методом. Оценивали соотношение vWF:RCo/vWF:Ag, значение данного показателя >0,7 соответствует 1-му типу БВ, до 0,7 — 2-му типу БВ.

Анализ мутаций в гене vWF

ДНК выделяли из периферической крови фенол- хлороформным методом. ПЦР проводили с исполь­зованием набора PCR Master Mix (2x) ((Thermo Fisher Scientific, Waltham, MA, USA). Нуклеотидные последовательности праймеров, температура отжига при ПЦР и использование бетаина (1/5 объема реак­ционной смеси) для амплификации GC-богатых фраг­ментов приведены в таблице 1. Очистку ПЦР про­дуктов для секвенирования проводили при помощи системы Wizard® PCR Preps DNA Purification System (Promega Corporation, Madison, WI, USA). Олигонуклеотидные праймеры синтезировали в ЗАО «Синтол» (Москва). Секвенирование проводили в ЦКП «Ге­ном» ИМБ РАН с помощью набора реактивов BigDye Terminator v.3.1 (Applied Biosystems, США) с после­дующим анализом продуктов реакции на автомати­ческом секвенаторе ABI PRISM 3100Avant (Applied Biosystems, США).

Найденные мутации анализировали с использо­ванием баз данных EAHAD (https://grenada.lumc.nl/LOVD2/VWF/home.php?select_db=VWF) и HGMD (http://www.hgmd.cf.ac.uk/ac/index.php).

Для определения патогенности новой мутации (Pro2527His) использовались следующие ресурсы: Mutation Taster, Provean, SIFT и PolyPhen.

Результаты

В данной работе проведен анализ мутаций в гене vWF у 15 больных БВ. В исследование был также вклю­чен больной, у которого первоначально была диагно­стирована легкая форма гемофилии А (FVIII 3,8 %), но при полном анализе гена F8 не найдено никаких отклонений от нормы. Исследовали структуру 23 эк- зонов из 52 (табл. 1), в которых сосредоточено около 90 % известных к настоящему времени мутаций в гене vWF. Патологические варианты гена vWF были выяв­лены у всех 16 больных (табл. 2, 3).

 

Таблица 1. Системы праймеров, использованные для амплификации и секвенирования гена vWF

Table 1. Primer sets used for amplification and sequencing of vWF gene

Номер экзона

Exon number

Система праймеров

Primer set

Позиция в гене vWF GeneBank NCBI NG_009072

Position in vWF gene GeneBank NCBI NG_009072

Тотж , °С

Tann , °С

Бетаин

Betain

3

CTGATGGTCCCAGTTGTGCC

TTCCGCTCAGACACTGTCCT

3275-3294

3660-3581

65

-

4-5

GCTGAGAAAAGGTTACGTAGA

GAAGGCATGTTAGTGAAGGTT

13608-13628

14381-14361

62

-

7

AAGTCTCAGTGCCACACTCA

CACAGCCCCGAAGCACCCTA

49052-49071

49422-49403

65

-

11-12

TGCAGTTTTGGGGAAGGGCA

GTTGAGAAGGAGGGTGCTAA

59291-59310

60494-60475

65

-

18

GATGCCCTCCCAGTCCCACA

CTCACTCATCCCTGCCTACA

8004-80064 80444-80425

65

+

19

GCTGGAGGAGGGCTTTAGAT

TGGAGGCAAGTGCGGAAGGT

88117-88136

88375-88356

62

-

25

CCAGACTAAGAGCCAGAGTTCC

CATCCAGTCCCTACTAACACT

100817-100838

101170-101150

65

+

26-27

CCAACATTATCTCCAGATGGC

TTACCCAAAACCTAGTCTCTAA

101674-101694

102853-102832

62

+

28

CAGAAGTGTCCACAGGTTCT

GCAGATGCATGTAGCACCAA

104871-104890

106380-106361

62

+

29-31

CACGCCCTGCAGATCCTATT

AAAGTAACCCCAGCCCACTT

107705-107724

108666-108647

62

+

33–34

CTCATGTCCCTATGTCTCCA

CCTGCTCTACTTTTCTGCACA

112383-112402

114134-113114

62

+

36-37

TGCAGGAACTCTCGGTAACT

GGCACAGAGAGGCTGAGCAA

129981-130000

130878-130859

65

+

42

GCACCCTATAGCATAGCTGA

CATGAGGAGCACATGTTGCT

142604-142623

143025-143006

65

-

43

GGTGCTAACTCACCGCTTGT

ACCCTTCCTAAGATGCCCTC

148346-148365

148634-148615

62

+

45

CGTCTAGAAACCACCTTCCT

TCGGTCCTATCCATTTCCCT

155181-155200

155577-155558

65

+

52

CCAGAGCCCTGCCTAAGCCA

CCTGCCCACCGTTGCCATCT

175400-175419

180843-180824

(NG_009072.1)

65

+

 

Таблица 2. Коагулогические и генетические характеристики больных БВ

Table 2. Coagulogical and genetic characteristics of vWD patients

Номер больного

Patient's No.

Тип БВ по фенотипу

vWD type by phenotype

Коагулогические тесты

Coagulogical tests

Экзон

Exon

Мутация

Mutation

Тип БВ по генотипу

VWD type by genotype

1

1

FVIII 7,9 % vWF:RCo 21 % AgVWF 7,9 % RIPA 37 %

45

c.7580 C>A Pro2527His

?

2

2

FVIII 22,6 % vWF:RCo 6,23 % AgVWF 14 % RIPA 88 %

26

c.3437 A>G Tyr1146Cys

2A

3

1

FVIII 28 % vWF:RCo 12,6 % AgVWF 18 % RIPA 69 %

28

c.4120 C>T Arg1374Cys

2A/2M

4

3

FVIII 10,1 % vWF:RCo 3 % AgVWF 3 % RIPA 5 %

18

28

c.2435delC c.4975 C>T Arg1659X

3

5

1

FVIII 3,3 % vWF:RCo 21,1 % AgVWF 6,5 % RIPA 4 %

18

37

c.2435delC c.6532 G>T Ala2178Ser

1 rec

6

3

FVIII 3,6 % vWF:RCo 1,21 % AgVWF 3,8 % RIPA 6 %

18

18

c.2435delC

c.2435delC

3

7

2

FVIII 55 % vWF:RC 6 % AgVWF 34 % RIPA 29 %

28

c.4825 G>A Gly1609Arg

2A

8

3

FVIII 6,7 % vWF:RCo 2,2 % AgVWF 0 % RIPA 10 %

18

18

c.2435delC

c.2435delC

3

9

2

FVIII 13 % vWF:RCo 109 % Ag VWF 27,5 % RIPA 92 %

18

18

c.2435delC c.2372 C>T Thr791 Met

2N

10

3

FVIII 9,25 % vWF:RCo 3,5 % AgVWF 0,8 % RIPA 6 %

18

c.2435delC

3

11

2

FVIII 105 % vWF:RCo 16,4 % Ag vWF 48,4 % RIPA 80 %

28

c.4790 G>A Arg1597Gln

2A

12

2

FVIII 53,6 % vWF:RCo 4,5 % AgVWF 571 % RIPA 89 %

28

c.4517 C>T Ser1506Leu

2A

13

3

FVIII 3,5 % vWF:RCo 2,1 % Ag VWF 2,7 % RIPA 11 %

18

25

c.2435delC c.3301 T>C Cys1101Arg

3

14

1

FVIII 20,9 % vWF:RCo 2,21 % AgVWF 1,4 % RIPA 17 %

7

c.817 C>T Arg273Trp

?

15

3

FVIII 2,5 % vWF:RCo 1,4 % AgVWF 2,1 RIPA 11 %

18

18

c.2435delC

c.2435delC

3

16

Гемофилия А

FVIII 3,8 %

18

18

c.2435delC c.2372 C>T Thr791 Met

2N

Примечание. Норма FVIII (50-120 %) vWF:RCo (50-150 %) vWF-Ag (50-150 %) RIPA (80-100 %).

Note. Norm of FVIII (50-120 %) vWF:RCo (50-150 %) vWF-Ag (50-150 %) RIPA (80-100 %).

 

 

Таблица 3. Мутации в гене vWF, выявленные у больных БВ

Table 3. Mutations in vWF gene identified in vWD patients

Примечание. (3)* — трое больных являлись гомозиготами по данной мутации.

Note. (3)* — three patients were homozygous by this mutation.

 

Микроделеция c.2435delC, локализованная в экзоне 18, оказалась в исследованной выборке больных самой распространенной, она трижды встретилась в гомози­готном состоянии (№ 6, 8 и 15) и шесть раз — в гете­розиготном (№ 4, 5, 8, 10, 13 и 16). У больных № 9 и 16 эта мутация сочеталась с миссенс-мутацией c.2372 C>T в том же экзоне.

В экзоне 28 выявили пять различных мутаций. У больного № 4 найдена не только мутация c.2435delC в 18-м экзоне, но и c.4975 C>T в 28-м экзоне. В гетеро­зиготном состоянии в этом экзоне найдены мутации: c.4120 C>T у больного № 3, c.4825 G>A у больного № 7, c.4790 G>A у больного № 11 и c.4517 C>T у боль­ного № 12.

В пяти экзонах было обнаружено по одной мутации. У больного № 2 в 26-м экзоне c.3437 A>G, у больно­го № 14 в 7-м экзоне c.817 C>T. У больных № 5 и 13 мутация c.2435delC была дополнена гетерозиготны­ми мутациями в других экзонах: в 37-м с.6532 и 25-м c.3301 T>C соответственно.

Отдельный интерес представляет мутация с.7580 C>A у больного № 1 в экзоне 45. Она не встречалась ранее в литературе, поэтому для определения пато­генности найденной вариации использовали различ­ные системы анализа белковых структур, которые дали следующие результаты: Mutation Taster (disease causing: p = 0,799), Provean (neutral: score —2,38), SIFT (damaging: score 0,018) и PolyPhen (HumDiv probably damaging: score 1,000, HumVar probably damaging: score 0,972). Таким образом, три из четырех использован­ных программ указали на патогенность найденной за­мены, а в системе Provean полученный коэффициент был близок к границе между нейтральностью и пато­генностью.

Обсуждение

В соответствии с клинической картиной заболевания и коагулогическими характеристиками, у 4 больных был определен тип 1 БВ, у 5 — тип 2 и у 6 — тип 3. У боль­ных БВ 3-го типа наблюдалось тяжелое течение болезни с высокой частотой геморрагических эпизодов и опреде­лялись низкие значения vWF-Ag (0—3,8 %) и vWF:RCo (1,21—3,5 %). У всех 6 больных была найдена одна и та же микроделеция в экзоне 18 c.2435delC, приводящая к синте­зу сильно укороченного нефункционального белка, при­чем у 3 больных в гомозиготном состоянии (№ 6, 8 и 15).

В группе больных, у которых мутации выявлены в го­мозиготном состоянии, наиболее выраженное пораже­ние опорно-двигательного аппарата наблюдалось у боль­ной № 6 (рис. 1). Дебют геморрагического синдрома у нее возник в раннем детском возрасте, а с 4 лет наблюдались рецидивирующие гемартрозы коленных суставов с последующим формированием тяжелой артропатии. В воз­расте 39 лет было произведено тотальное эндопротезиро­вание левого коленного сустава. Кроме того, у больной в анамнезе были меноррагии и апоплексия яичников.

 

Рисунок 1. А — генеалогические данные больной БВ (№ 6) с 3-м типом БВ Б — рентгенологические снимки левого коленного сустава больной с признаками гемартроза

Figure 1. А — pedigree of the patient №6 with WD 3 type. Б — Roentgenograms of the left knee-joint of the patient with hemarthrosis signs

 

Мутация с.2435delC широко распространена в странах Балтии, но найдена также и в других европейских популя­циях [17, 18]. У больной № 4 она встретилась в сочетании с нонсенс-мутацией Arg1659X, также приводящей к синте­зу укороченного нефункционального белка и являющейся мажорной в Финляндии [19], а у больной № 13 — в соче­тании с миссенс-мутацией Cys1101Arg в области гена vWF, кодирующей домен D3. Замены цистеина в домене D3 обычно приводят к нарушению мультимеризации vWF.

Кроме того, данная микроделеция в сочетании с дру­гими мутациями была выявлена у больных БВ 1-го (№ 5) и 2-го (№ 9) типов, а также у больного, у кото­рого первоначально были диагностирована гемофилия А (№ 16). У больного № 10 мутация c.2435delC оказа­лась в гетерозиготном состоянии и других мутаций не найдено. Возможно, у него есть дополнительная му­тация в одном из экзонов, не охваченных в данном ис­следовании. У больной № 5 микроделеция c.2435delC была идентифицирована в сочетании с миссенс-мутацией Ala2178Ser. Низкие уровни vWF-Ag (6,5 %) и активности FVIII (3,3 %) в сочетании с высокой оста­точной vWF:RCo (21,1 %) свидетельствуют в данном случае в пользу редкой рецессивной формы БВ 1-го типа. У этой больной наблюдался геморрагический синдром (меноррагии, длительные кровотечения по­сле удаления зубов), и по поводу поликистоза яични­ков, полипов эндометрия, внематочной беременности ей выполнялись оперативные вмешательства на фоне гемостатической терапии концентратом FVIII, сбалан­сированным по vWF. К настоящему времени отмечает­ся отсутствие геморрагического синдрома, специфиче­ская гемостатическая терапия не требуется.

У больной № 9 и больного № 16 вторым дефек­том была миссенс-мутация Thr791Met, относящаяся к группе рецессивных вариантов vWF, при которых нарушено связывание с FVIII [20]. Таким образом, оба этих случая можно классифицировать как БВ типа 2N. У многих больных данным вариантом БВ ранее диагностировали гемофилию А легкой или умеренной степени тяжести [13, 21]. У больной № 9 наблюдалась клиническая картина рецидивирующих десневых кро­вотечений, длительных луночковых кровотечений по­сле удаления зубов, меноррагий, послеоперационных (аппендэктомия) гематом. Диагноз БВ был верифи­цирован в возрасте 23 лет. Амбулаторно наблюдается в НМИЦ гематологии с 1994 г. Отмечено волнообраз­ное течение заболевания с отсутствием клинических проявлений до 6 мес. В настоящее время, учитывая сопутствующий множественный генерализованный пародонтит, больной планируется хирургическая са­нация полости рта на фоне гемостатической терапии концентратом FVIII/vWF (450/400) (нагрузочная доза 70 МЕ/кг, поддерживающая доза 25 МЕ/кг).

Дифференциальная диагностика БВ по типам и под­типам довольно часто представляет собой непростую задачу, особенно это относится к 1-му типу заболе­вания, которое может иметь как доминантную, так и рецессивную форму наследования. У больной № 14 с предполагаемым 1-м типом БВ на настоящий момент времени выявлена только миссенс-мутация Arg273Trp в гетерозиготном состоянии. Известно, что гомозиготность по этому генетическому дефекту приводит к нарушению мультимеризации и секреции vWF и ассоциируется с 3-м типом заболевания [22, 23]. Наблю­дающиеся крайне низкие показатели vWF:RCo (2,21 %) и vWF-Ag (1,4 %) предполагают возможное наличие у больной нарушения и во втором аллеле, и в данном случае необходимо полное исследование гена vWF.

У больной № 3 выявлена в гетерозиготной форме миссенс-мутация Arg1374Cys, которую ранее относили к 1-му типу БВ, но затем было показано, что она соот­ветствует 2А/2М типам заболевания [24, 25]. Данное нарушение локализовано в домене А1 и вызывает абер­рантную мультимеризацию белка.

У больного № 1 с предполагаемым 1-м типом БВ была обнаружена в гетерозиготном состоянии миссенс-мутация Pro2527His, единственная из найденных нами в данном исследовании мутаций, не описанная в литературе. Локализованные в соседних участках домена С1 замены Gln2520Pro и Gly2518Ser нарушают мультимеризацию белка и соответствуют 1-му типу БВ [25]. По нашим данным, она оказалась патогенной. Ос­новные геморрагические проявления у этого больного представляли собой рецидивирующие носовые крово­течения, кроме того, возникали кровоизлияния в скле­ру глаз на фоне подъема АД до 130/90 мм рт. ст. В воз­расте 62 лет после операции уретеролитоэкстракции возникла гематурия. При обследовании был верифи­цирован диагноз БВ 1-го типа и диагностирована моно­клональная гаммапатия. Секреция белка Бенс-Джонса не выявлена. Больной получает гемостатическую тера­пию концентратом FVIII/vWF (450/400) в профилакти­ческом режиме 2700 МЕ х 2 раза в неделю.

У 4 больных БВ 2-го типа были выявлены в гетеро­зиготном состоянии известные доминантные миссенс- мутации, нарушающие мультимеризацию vWF. В трех случаях (№ 7, 11 и 12) они были найдены в экзоне 28, где чаще всего встречаются нарушения, приводящие к БВ 2-го типа [14]. Все три мутации (Ser1506Leu, Arg1597Gln, Gly1609Arg) были локализованы в области гена, коди­рующей домен А2. У больной № 2 мутация Tyr1146Cys была найдена в экзоне 26, кодирующем домен D3.

Таким образом, в данном исследовании были опреде­лены мутации в гене vWF у 16 больных БВ. Всего было выявлено 12 различных мутаций, одна из которых (Pro2527His) оказалась новой. Наиболее распростра­ненной в отечественной популяции является микро­делеция c.2435delC, встретившаяся у 9 из 16 больных преимущественно с 3-м типом заболевания, причем у 3 больных — в гомозиготном состоянии. В целом, данные молекулярно-генетического анализа соответ­ствовали результатам дифференциальной диагностики типа БВ, основанной на клинической картине заболева­ния и коагулогических характеристиках. Только в од­ном случае у больной предполагаемым 1-м типом БВ была выявлена мутация, характерная для типа 2 (A/M), и еще в 2 случаях уточнен подтип 2-го типа заболева­ния (2N). Из 24 найденных мутаций 14 пришлись на эк- зон 18 (преимущественно это была делеция c.2435delC) и еще 5 — на экзон 28. Из этих результатов следует, что начинать поиск мутаций в гене vWF целесообразно с экзонов 18 и 28. Полученные данные могут послужить основой для создания экономичного алгоритма поиска мутаций в гене vWF у отечественных больных БВ.

Список литературы

1. Rodeghiero F., Castaman G., Dini E. Epidemiological investigation of the prevalence of von Willebrand’s disease. Blood. 1987; 69: 454–9.

2. Werner E.J., Broxson E.H., Tucker E.L. et al. Prevalence of von Willebrand disease in children: a multiethnic study. J Pediatr. 1993; 123: 893–8.

3. Zimmerman T., Ruggeri Z. Von Willebrand disease. Human Pathology. 1987; 18(2): 140–52. DOI: 10.1016/S0046-8177(87)80332-5

4. Mancuso D.J., Turley E.A., Westfi eld L.A. et al. Structure of the gene for human von Willebrand factor. J Biol Chem. 1989; 264(33): 19514–27.

5. Mancuso D.J., Tuley E.A., Westfi eld L.A. et al. Human von Willebrand factor gene and pseudogene: structural analysis and differentiation by polymerase chain reaction. Biochemistry. 1991; 30(1): 253–69. DOI: 10.1021/bi00215a036

6. Sadler J. A Revised Classifi cation of von Willebrand Disease. Thromb Haemost. 1994; 72(04): 520–5. DOI: 10.1055/s-0038-1642471

7. Federici A.B., Castaman G., Thompson A., Berntorp E. Von Willebrand’s disease: clinical management. Haemophilia. 2006; 12(3): 152–8.

8. Federici A.B., Mannucci P.M. Diagnosis and management of von Willebrand diasease. Haemophilia. 1999; 5(2): 28–37.

9. Blomback M., Eikenboom J., Lane D. et al. Von Willebrand disease biology. Haemophilia. 2012; 18(4): 141–7.

10. Баркаган З.С. Болезнь Виллебранда. В кн.: Руководство по гематологии. Ред. Воробьев А.И. М.: Ньюдиамед. 2005; 3: 71–3.

11. Drewke E., Krey S., Schneppenheim R., Budde U. A variant of von Willebrand disease (Type 2N) resembling phenotypically mild or moderately severe haemophilia. Infusionsther Transfusionsmed. 1995; 22 (1): 48–50.

12. Папаян Л.П., Головина О.Г. Вариантные формы болезни Виллебранда. Терапевтический архив. 1990; 7: 86–92.

13. Mazurier C. Von Willebrand disease masquerading as haemophilia A. Thromb. Haemost. 1992; 67: 391–6.

14. Goodeve A.C. The genetic bases of von Willebrand disease. Blood Reviews. 2010; 24: 123–34. DOI: 10.1016/j.blre.2010.03.003

15. Flood V.H. New insights into genotype and phenotype of VWD. Hematology. 2014; 2014(1): 531–5. DOI: 10.1182/asheducation-2014.1.531

16. Лихачева Е.А., Полянская Т.Ю., Зоренко В.Ю. и др. Клинические рекомендации по диагностике и лечению болезни Виллебранда. М.: Национальное гематологическое общество, 2014.

17. Zhang Z.P., Falk G., Blombäck M. et al. A single cytosine deletion in exon 18 of the von Willebrand factor gene is the most common mutation in Swedish vWD type III patients. Hum Mol Genet. 1992; 1(9): 767–8.

18. Schneppenheim R., Krey S., Bergmann F. et al. Genetic heterogeneity of severe von Willebrand disease type III in the German population. Hum Genet. 1994; 94 (6): 640–52.

19. Jokela V., Lassila R., Szanto T. et al. Phenotypic and genotypic characterization of 10 Finnish patients with von Willebrand disease type 3: discovery of two main mutations. Haemophilia. 2013; 19(6): 344–8. DOI: 10.1111/hae.12225

20. Gaucher C., Jorieux S., Mercier B. et al. The “Normandy” variant of von Willebrand disease: characterization of a point mutation in the von Willebrand factor gene. Blood. 1991; 77(9): 1937–41.

21. Casonato A., Galletta E., Sarolo L., Daidone V. Type 2N von Willebrand disease: Characterization and diagnostic diffi culties. Haemophilia. 2018; 24(1): 134–40. DOI: 10.1111/hae.13366

22. Allen S., Abuzenadah A.M., Hinks J. et al. A novel von Willebrand diseasecausing mutation (Arg273Trp) in the von Willebrand factor propeptide that results in defective multimerization and secretion. Blood. 2000; 96(2): 560–8.

23. Bowman M., Tuttle A., Notley C. et al. The genetics of Canadian type 3 von Willebrand disease: further evidence for co-dominant inheritance of mutant alleles. J Thromb Haemost. 2013; 11(3): 512–20. DOI: 10.1111/jth.12130

24. Hilbert L., Gaucher C., Mazurier C. Identifi cation of two mutations (Arg611Cys and Arg611His) in the A1 loop of von Willebrand factor (vWF) responsible for type 2 von Willebrand disease with decreased platelet-dependent function of vWF. Blood. 1995; 86(3): 1010–8.

25. Goodeve A., Eikenboom J., Castaman G. et al. Phenotype and genotype of a cohort of families historically diagnosed with type 1 von Willebrand disease in the European study, Molecular and Clinical Markers for the Diagnosis and Management of Type 1 von Willebrand Disease (MCMDM-1VWD). Blood. 2007; 109(1): 112–21.

26. Gadisseur A., Berneman Z., Schroyens W. et al. Laboratory diagnosis of von Willebrand disease type 1/2E (2A subtype IIE), type 1 Vicenza and mild type 1 caused by mutations in the D3, D4, B1–B3 and C1–C2 domains of the von Willebrand factor gene. Role of von Willebrand factor multimers and the von Willebrand factor propeptide/antigen ratio. Acta Haematol. 2009;121(2- 3):128–38. Doi: 10.1159/000214853.

27. James P.D., Notley C., Hegadorn C. et al. The mutational spectrum of type 1 von Willebrand disease: Results from a Canadian cohort study. Blood. 2007; 109(1):145–54.

28. Pérez-Casal M., Daly M., Peake I. et al. A de novo mutation in exon 28 of the von Willebrand factor gene in a patient with type IIA von Willebrand’s disease coincides with an MboI polymorphism in the von Willebrand factor pseudogene. Hum Mol Genet. 1993;2(12):2159–61.

29. Ginsburg D., Konkle B.A., Gill J.C. et al. Molecular basis of human von Willebrand disease: analysis of platelet von Willebrand factor mRNA. Proc Natl Acad Sci U S A. 1989;86(10):3723–7.

30. Donnér M., Kristoffersson A.C., Berntorp E. et al. Two new candidate mutations in type IIA von Willebrand’s disease (Arg834-->Gly, Gly846-->Arg) and one polymorphism (Tyr821-->Cys) in the A2 region of the von Willebrand factor. Eur J Haematol. 1993;51(1):38–44.

31. Cumming A., Grundy P., Keeney S. et al. An investigation of the von Willebrand factor genotype in UK patients diagnosed to have type 1 von Willebrand disease. Thromb Haemost. 2006;96(5):630–41.


Об авторах

Д. М. Чернецкая
ФГБУ «Национальный медицинский исследовательский центр гематологии» Министерства здравоохранения Российской Федерации
Россия

научный сотрудник лаборатории генной инженерии, 

125167, Москва



Е. А. Лихачева
ФГБУ «Национальный медицинский исследовательский центр гематологии» Министерства здравоохранения Российской Федерации
Россия

Научно-консультативный отдел коагулопатий, кандидат медицинских наук, врач-гематолог, 

125167, Москва

 



О. С. Пшеничникова
ФГБУ «Национальный медицинский исследовательский центр гематологии» Министерства здравоохранения Российской Федерации
Россия

старший научный сотрудник лаборатории генной инженерии,

125167, Москва



В. Л. Сурин
ФГБУ «Национальный медицинский исследовательский центр гематологии» Министерства здравоохранения Российской Федерации
Россия

старший научный сотрудник лаборатории генной инженерии,

125167, Москва



Н. И. Зозуля
ФГБУ «Национальный медицинский исследовательский центр гематологии» Министерства здравоохранения Российской Федерации
Россия

врач-гематолог, заведующая научно-консультативным отделом коагулопатий,

125167, Москва



Для цитирования:


Чернецкая Д.М., Лихачева Е.А., Пшеничникова О.С., Сурин В.Л., Зозуля Н.И. БОЛЕЗНЬ ВИЛЛЕБРАНДА: СОПОСТАВЛЕНИЕ КЛИНИЧЕСКИХ, КОАГУЛОГИЧЕСКИХ И МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКИХ ДАННЫХ. Гематология и трансфузиология. 2019;64(3):246-255. https://doi.org/10.35754/0234-5730-2019-64-3-246-255

For citation:


Chernetskaya D.M., Likhacheva E.A., Pshenichnikova O.S., Surin V.L., Zozulya N.I. VON WILLEBRAND DISEASE: CLINICAL, COAGULOGICAL, MOLECULAR AND GENETIC DATA COMPARISON. Russian journal of hematology and transfusiology. 2019;64(3):246-255. (In Russ.) https://doi.org/10.35754/0234-5730-2019-64-3-246-255

Просмотров: 423


Creative Commons License
Контент доступен под лицензией Creative Commons Attribution 4.0 License.


ISSN 0234-5730 (Print)
ISSN 2411-3042 (Online)