Preview

Гематология и трансфузиология

Расширенный поиск

СРАВНЕНИЕ МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКОЙ СТРУКТУРЫ ОПУХОЛЕВЫХ КЛЕТОК ДО ЛЕЧЕНИЯ И ПОСЛЕ КОНСТАТАЦИИ РЕЦИДИВА МНОЖЕСТВЕННОЙ МИЕЛОМЫ (КРАТКИЙ ОБЗОР И ОПИСАНИЕ КЛИНИЧЕСКОГО СЛУЧАЯ)

https://doi.org/10.35754/0234-5730-2019-64-3-362-374

Полный текст:

Аннотация

Введение. Множественная миелома (ММ) является лимфопролиферативным заболеванием, длительность ремиссии которого сложно прогнозировать.

Цель работы: проанализировать молекулярно-генетический статус опухоли у больного с коротким периодом ремиссии в дебюте и рецидиве ММ и сопоставить с клиническим течением заболевания.

Материалы и методы. Соматические мутации определяли методом секвенирования по Сэнгеру. Уровень экспрессии генов анализировали с помощью секвенирования РНК на платформе Illumina. Для изучения хромосомных перестроек проводили флуоресцентную гибридизацию in situ (FISH-исследование).

Результаты. До начала лечения и в рецидиве заболевания у больного выявлена гетерозиготная клональная мутация с.182A>C (p.Q61P) в гене N-RAS, нарушающая регуляцию сигнального пути МАРК. Транскриптомный анализ, выполненный методом RNA-seq, показал резкое усиление экспрессии гена IL6 при рецидиве (в 30 раз), которое могло послужить пусковым механизмом прогрессии множественной миеломы, поскольку этот цитокин стимулирует клеточную пролиферацию, активируя различные сигнальные пути (MAPK, JAK-STAT, PI3K). Прогрессия заболевания сопровождалась также усилением экспрессии ключевых регуляторных генов (с-MYC, Notch2, MDM, RAF1, STAT4, mTOR) и резким уменьшением экспрессии генов иммуноглобулинов, вызвавшим у больного глубокий иммунодефицит. При молекулярно-цитогенетическом исследовании (FISH) в дебюте заболевания была выявлена трисомия по хромосомам 5, 9, и 15. Рецидив заболевания сопровождался амплификацией локуса 1q21 при сохранении гипердиплоидии.

Заключение. Для прогноза длительности периода ремиссии необходимо проводить комплексный молекулярногенетический скрининг. 

Для цитирования:


Сергеева А.М., Абрамова Т.В., Сурин В.Л., Обухова Т.Н., Довыденко М.В., Сунцова М.В., Буздин А.А., Менделеева Л.П. СРАВНЕНИЕ МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКОЙ СТРУКТУРЫ ОПУХОЛЕВЫХ КЛЕТОК ДО ЛЕЧЕНИЯ И ПОСЛЕ КОНСТАТАЦИИ РЕЦИДИВА МНОЖЕСТВЕННОЙ МИЕЛОМЫ (КРАТКИЙ ОБЗОР И ОПИСАНИЕ КЛИНИЧЕСКОГО СЛУЧАЯ). Гематология и трансфузиология. 2019;64(3):362-374. https://doi.org/10.35754/0234-5730-2019-64-3-362-374

For citation:


Sergeeva A.M., Abramova T.V., Surin V.L., Obukhova T.N., Dovydenko M.V., Suntsova M.V., Buzdin A.A., Mendeleeva L.P. MOLECULAR GENETIC STRUCTURE OF MULTIPLE MYELOMA TUMOUR CELLS PRIOR TO TREATMENT AND AT THE TIME OF RELAPSE: SHORT REVIEW AND CASE REPORT. Russian journal of hematology and transfusiology. 2019;64(3):362-374. (In Russ.) https://doi.org/10.35754/0234-5730-2019-64-3-362-374

Введение

Множественная миелома (ММ) относится к злокаче­ственным заболеваниям системы крови с клональной пролиферацией плазматических клеток. Патогенез ММ представляет собой многоступенчатый процесс трансформации генетического материала клетки, ко­торый изучен лишь частично [1]. Молекулярно-ци­тогенетическое исследование клеток костного мозга у больных ММ является рутинным методом обсле­дования, по результатам которого проводится стра­тификация больных на группы риска и стадирование ММ. При цитогенетическом исследовании определя­ются: транслокации с вовлечением локуса генов IGH 14-й хромосомы, наличие трисомий по целому ряду нечетных хромосом, делеция короткого плеча 17-й хромосомы, моносомия или делеция длинного плеча 13-й хромосомы (del13q) и амплификация локуса 1q21 (amp1q21) [2]. Наряду с этим для тестирования точеч­ных мутаций в генах, ассоциированных с развитием ММ, широко используется метод секвенирования по Сэнгеру, позволяющий получать надежные резуль­таты при анализе последовательности ДНК на пред­мет единичных нуклеотидных замен, микроделеций и микроинсерций коротких участков длиной от одного нуклеотида до нескольких десятков оснований. Одна­ко этот метод пригоден только для анализа мутаций, носящих клональный характер или присутствующих в субклонах, составляющих не менее 10 % от общей опухолевой массы. Исследования с использованием современных методов секвенирования показали высо­кую гетерогенность различных генетических наруше­ний при ММ [3, 4].

По данным, полученным на большой выборке боль­ных с использованием секвенирования полного эк- зома (whole exome sequencing, WES), наиболее часто встречающимися нарушениями у больных ММ явля­ются точечные мутации в генах сигнального MAPK- пути (N-RAS, K-RAS, BRAF) и онкосупрессора ТР53, которые суммарно встречаются примерно у половины больных [5].

В патогенезе ММ нарушается регуляция транс­крипции целого ряда генов, таких как C-MYC, MMSET (NSD2), CCND1, CCND2, CKS1B, Notch2, IL-6, MDM2. В результате появляется понятие «профиля» экспрес­сии генов, различные варианты которого могут иметь прогностическое значение, определяя характер тече­ния заболевания и его резистентность к терапии [6].

Гены семейства RAS. Гены семейства RAS — наибо­лее часто мутирующие гены при ММ. В исследовании W. Chng и соавт. [7] частота встречаемости мутаций генов семейства RAS составила 23 % (102/561), из них у 74 (17 %) были выявлены мутации в гене N-RAS, у 28 (6 %) — в гене К-RAS. Большинство мутаций было детектировано в кодоне 61-го гена N-RAS (64 из 74). По данным литературы [8], активирующие миссенсмутации в генах N-RAS и К-RAS изменяют свойства соответствующих белков и превращают протоонкоге­ны в онкогены. Функциональная нагрузка таких му­таций заключается в том, что белки RAS теряют ГТФазную активность, вследствие чего нарушается их нормальная регуляция цитокинами в передаче митоген-активирующего сигнала к ядру, что приводит к по­вышенной пролиферации клеток [8]. Стадия, предше­ствующая ММ, моноклональная гаммапатия неясного генеза (МГНГ), на молекулярном уровне отличается от ММ отсутствием мутаций в генах семейства RAS [9]. Имеющиеся в литературе сведения о роли акти­вирующих мутаций в генах K-RAS и N-RAS в патоге­незе ММ весьма противоречивы. По одним данным, они считаются фактором неблагоприятного прогноза, ассоциируются с прогрессией заболевания и меньшей общей выживаемостью, по другим — могут влиять только на резистентность к терапии определенными препаратами (например, бортезомибом) [7, 10, 11].

BRAF. Киназа BRAF передает сигнал от RAS бел­ков к нижестоящим эффекторным белкам сигнально­го пути МАРК. Частота мутаций в гене BRjAF при ММ варьирует от 4 до 14,9 % [12]. Чаще всего встречает­ся активирующая мутация в 600-м кодоне с заменой валина на глютаминовую кислоту (V600E). Показано [13], что эта мутация ассоциируется с клинически бо­лее агрессивным течением ММ, более низкими пока­зателями общей выживаемости, а также с высокой ча­стотой (>50 %) выявления экстрамедуллярных очагов.

TP53. Опухолевый супрессор p53 является транс­крипционным фактором. Этот белок связывается с промоторами различных генов и может как активи­ровать, так и ингибировать их транскрипцию. Белок p53 вовлечен в репликацию и репарацию ДНК. От­сутствие гена ТР53 ведет к развитию синдрома Ли — Фраумени, проявляющегося предрасположенностью к отдельным новообразованиям и возникновению пер­вично-множественных опухолей [14]. Известен спектр нарушений, ведущих к дисфункции белка p53. Сюда относятся мутации гена TP53, метилирование его регу­ляторных областей, нарушение транспорта белка p53 в ядро, амплификация ингибитора p53 белка mdm2, связывание с вирусным белком E6, которое ведет к деградации p53 [14]. Кроме того, при делеции ко­роткого плеча хромосомы 17 (p17del) одна копия гена утрачивается полностью. Инактивация белка p53 счи­тается универсальным изменением в опухолевой клет­ке и встречается в 50—60 % новообразований. В основ­ном генные нарушения встречаются в гетерозиготном состоянии, представлены миссенс-мутациями, приво­дящими к аминокислотным заменам, и затрагивают чаще всего ДНК-связывающий домен. В результате подобных мутаций происходит изменение вторичной структуры белка и появление новых свойств, таких как способность активировать экспрессию некоторых генов, к которым относятся с-MYC, CCND1, MRD1. Усиление экспрессии MRD1 связано с появлением множе­ственной лекарственной устойчивости у клеток опухо­ли [15].

с-MYC. Протоонкоген с-MYC задействован во многих путях передачи сигналов от рецепторных комплексов на поверхности мембраны клетки. Его экспрессия на­ходится под контролем целого набора транскрипцион­ных регуляторов [16]. Белок c-myc вовлечен в большое число внутриклеточных взаимодействий, его повы­шенная экспрессия ассоциирована с начальными ста­диями неопластической трансформации клеток и уси­лением их пролиферации [17]. В спектр функций c-myc входит регуляция внутриклеточных систем энергообе­спечения — гликолиза, метаболизма глютамина и би­огенеза митохондрий, которые приводят к аккумуля­ции энергии для репликации ДНК и деления клетки [18]. Повышенная экспрессия этого белка ассоцииру­ется с геномной нестабильностью, вызываемой стиму­ляцией митохондрий, которая приводит к наработке активных форм кислорода [19], и в частности может быть связана с появлением транслокаций [20].

MMSET (NSD2). Белок MMSET (multiple myeloma SET domain) является гистонметилтрансферазой и принимает участие в реорганизации хроматина. Его повышенная экспрессия наблюдается на началь­ных стадиях патогенеза ММ. Транслокация с участи­ем гена MMSET t(4;14) является фактором неблаго­приятного прогноза. Искусственная репрессия белка MMSET приводит к пониженному темпу пролифера­ции, индукции апоптоза и клеточной агдезии [21].

CCND1 и CCND2. Высококонсервативные белки из семейства D-циклинов, CCND1 и CCND2, пред­ставляют собой регуляторные субъединицы киназ, необходимые для перехода клетки из G1 в S-фазу кле­точного цикла. Эти белки взаимодействуют с опухоле­вым супрессором Rb, и их экспрессия положительно регулируется Rb. Результатом ранних событий в пато­генезе множественной миеломы, таких как IGH-транс­локации, появление гипердиплоидности и трисомии, является гиперэкспрессия этих циклинов [22].

CKS1B. Увеличение экспрессии гена субъединицы 1В циклинкиназы является фактором неблагоприятного прогноза при ММ. Функция CKS1B заключается в ак­тивации циклина через его фосфорилирование [23]. Ген расположен на длинном плече 1-й хромосомы, его амплификация регулярно встречается среди генетиче­ских нарушений множественной миеломы [24].

Notch2. Белки семейства Notch вовлечены в регу­ляцию гемопоэза. Отсутствие белков этого семейства ведет к нарушению поздних стадий дифференцировки В-клеток [25]. Нарушение регуляторных механизмов работы рецепторов или их лигандов, входящих в сиг­нальный путь Notch, исследовано в различных типах злокачественных солидных и гематологических опу­холей, в том числе и при ММ. Ингибирование Notch индуцирует апоптоз в клетках опухоли, уменьшает устойчивость к лекарственным препаратам, изменяет характеристики миграции/рециркуляции плазма­тических клеток и их обновление [26]. Notch может участвовать в прогрессии ММ, увеличивая уровень интерлейкина-6 (IL-6), одного из ключевых факторов, стимулирующих клеточную пролиферацию [27].

Интерлейкин-6. Представляет собой цитокин плей- отропного действия. Он индуцирует дифференцировку и рост разных типов клеток, в том числе дифференцировку нормальных B-клеток в плазматические клетки, производящие антитела. Пролиферативная активность клеток множественной миеломы зависит от IL-6, осуществляющего ее аутокринную регуляцию [28]. Экспрессия IL-6 ассоциирована с агрессивным течением заболевания, высоким пролиферативным индексом и устойчивостью к лекарственным препара­там, запускающим апоптоз [29]. Повышение активно­сти IL-6 связано с остеодеструкцией — повышенной активностью и пролиферацией остеокластов и пони­жением количества остебластов при ММ [30]. Высо­кий уровень экспрессии IL-6 является фактором пло­хого прогноза при ММ.

MDM2 (murine double minute 2) — белок ингибитор TP53. Изначально ген этого белка был идентифи­цирован в экстрахромосомной ДНК, образующейся в раковых клетках. Его взаимодействие с TP53 ве­дет к тому, что комплекс MDM2/TP53 направляется из ядра в цитоплазму, где подвергается убиквитинированию. В условиях стресса сайты связывания MDM2 и TP53 фосфорилируются, и комплекс, в ко­тором TP53 не активен, не образуется. В результате белок TP53 переходит из латентной формы в активи­рованную форму, запускает процессы остановки кле­точного цикла и апоптоза. Гиперэкспрессия MDM2 — типичный механизм разоружения раковой клетки, лишающий ее защитных функций опухолевого су­прессора TP53 [31].

Цель исследования — проанализировать молеку­лярно-генетический статус опухоли у больного ММ с коротким периодом ремиссии в дебюте и рецидиве заболевания и сопоставить с клиническим течением заболевания.

Материалы и методы

Пункцию костного мозга для молекулярно-генети­ческого скрининга (fluorescence in situ hybridization (FISH), измерение экспрессии и мутационный статус генов) проводили дважды — в дебюте и рецидиве ММ.

Для оценки значимости изменения величин экс­прессии генов регуляторных белков у больного ММ в дебюте и рецидиве заболевания сравнивали их с со­ответствующими показателями для клеток CD138+, по­лученных от 10 доноров (5 женщин, 5 мужчин в возра­сте от 25 до 41 года). Если значение экспрессии гена у больного вписывалось в диапазон значений, харак­терных для доноров, считали, что оно находится в пре­делах нормы.

Выделение мононуклеаров из костного мозга и CD138-кле­ток. Используя градиент плотности фиколла (1,077 г/ см3), из костномозговой взвеси выделяли фракцию мононуклеаров. В дальнейшем проводилась высоко­активная магнитная сепарация согласно протоколу Miltenyi Biotec (Miltenyi Biotec GmbH, Germany, http://www.miltenyibiotec.com) с использованием магнитного сепаратора OctoMacs, антител anti-CD138, конъюги­рованных с 50-нм частицами оксида железа и анти­тел anti-CD138, конъюгированных с фикоэритрином. Чистота выделения мононуклеаров, обогащенных С0138+-клетками, в дебюте (установка диагно­за 29.05.2013) и прогрессии (констатация рецидива 01.08.2014) составила 80 и 70 % соответственно. В даль­нейшем полученные мононуклеары и С0138+-клетки использовали для проведения FISH-исследования, из­мерения уровня экспрессии генов и определения мута­ционного статуса генов.

Флуоресцентная гибридизация in oitu (FISH). Молеку­лярно-цитогенетическое исследование клеток костно­го мозга выполняли в лаборатории кариологии ФГБУ «НМИЦ гематологии» Минздрава России. В дебюте заболевания FISH-исследование проводилось на моно- нуклеарах костного мозга для выявления первичных (t(14q32)/IGH, множественные трисомии) и вторичных (del 17p13/TP53, del13q14/-13, del1p32, amp1q21 и t(8q24)/ cMYC) хромосомных аномалий. В прогрессии заболе­вания на сепарированных С0138+-клетках проводил­ся повторный FISH-анализ с ДНК-зондами для вы­явления del17p13/TP53, del13q14/-13, del1p32, amp1q21, t(8q24)/cMYC и множественных трисомий. В работе использовали различные центромерные и локус-спе- цифичные ДНК-зонды: XL IGHplus, XL P53, XL cMYC BA, XL 1p32/1q21, XL 5p15/9q22/15q22 Hyperdiploidy Amplification Probe (MetaSystems, Germany) и D13S25 (Cytocell, UK). Исследование проводили согласно про­токолам производителей. Для каждого зонда анализи­ровали по 200 интерфазных ядер с четкими сигналами. Результаты FISH-анализа описывали в соответствии с международной номенклатурой (International System for Cytogenetic Nomenclature, ISCN, 2013) [32].

Анализ экспрессии генов. Тотальную фракцию РНК выделяли из плазматических клеток костного мозга с поверхностным маркером CD138+ при помощи лизи­са в гуанидин-изотиоцианатном буфере с последую­щей очисткой стандартным фенол-хлороформным ме­тодом. Полученную РНК хранили при температуре —70 °С в EtOH. Для анализа экспрессии генов исполь­зовали метод секвенирования РНК нового поколения (RNA-seq). Анализ проводили на приборе Illumina HiSeq (Illumina, США) с использованием наборов для подготовки библиотеки транскриптома тоталь­ной РНК (Whole-transcriptome analysis with total RNA sequencing). Выравнивание полученных после секвенирования последовательностей на референсный геном и сборка транскриптома проводилось с помо­щью программного обеспечения STAR [33]. Пересчет уровня экспрессии генов был выполнен в программе DESeq2. Числовые значения экспрессии (normalized gene counts, ngc) представляют собой абсолютные значения, полученные при сборке и выравнивании транскрипта гена на последовательность референс- ного гена с последующим нормированием на глубину секвенирования [34]. Для определения значимости различий между экспрессией в опухолевых клетках в дебюте и рецидиве заболевания полученные зна­чения приведены с меньшим и большим диапазоном значений экспрессии в плазматических клетках 10 до­норов (табл. 1).

 

Таблица 1. Изменения уровня экспрессии генов в дебюте ММ и при констатации рецидива у больного в сравнении со значениями экспрессии этих генов у доноров

Table 1. Gene expression fold changes are at the time of diagnosis and progression in comparison with a range of gene expression values for a group of donors

Гены

Genes

Доноры (n = 10) Donors (n = 10)

Больной

Patient

минимальное значение, ngc

min value, ngc

максимальное значение, ngc

max value, ngc

дебют заболевания, ngc

disease debut, ngc

рецидив заболевания, ngc

disease relapse, ngc

с-myc

188

493

1374

2074

CCND1

5

981

117

12

CCND2

332

4592

4383

613

MMSET(NSD2)

611

1608

338

1195

Notch2

945

2276

1763

5805

CKS1B

4

40

17

29

IL6

2

41

33

953

TP53

166

479

237

210

MDM2

384

910

1821

4458

RAF1

706

1395

791

1710

STAT4

22

143

46

145

mTOR

456

723

625

1585

Клональные IGH/L

Сlonal IGH/L

IGHG2

35146

280485

628255

67532

IGHM

46047

279812

2118

298

IGHV3-33

811

11080

13954

1246

IGLC2

25465

126208

242255

22381

IGLV1-44

1460

6682

21176

1491

Неклональные IGH

Non-clonal IGH

IGHV3-23

8970

48891

940

14

IGHV2-5

3204

15381

1613

36

Примечание. ngc — normalized gene counts, единица измерения экспрессии гена, выраженная в количестве прочтений гена, нормированного на общее число прочтений в образце.

Note. ngc — normalized gene counts (units of given values).

 

Анализ соматических мутаций. Соматические мута­ции в геномной ДНК плазматических клеток CD138+ костного мозга анализировали методом секвенирования по Сэнгеру. В данной работе исследовались кодирующие области генов N-RAS, K-RAS, TP53, и экзон 15 гена BRAF. Геномную ДНК выделяли ме­тодом фенол-хлороформной экстракции. Клетки лизировали в 1 мл STE (Sodium Chloride-Tris-EDTA) буфера, содержащего 1 % додецлсульфат натрия (SDS) и протеиназу К (200 мкг/мл), в течение ночи при 37 °С или двух часов при 60 °С с последующей фенольной экстракцией.

Для постановки полимеразной цепной реакции (ПЦР) использовали смесь PCR Master Mix (2X) Thermo Scientific™, 0,01—0,02 мкг геномной ДНК и 10 пкмоль каждого из праймеров в усредненных условиях (94 °С — 1 мин., 60—62 °С — 1 мин., 72 °С — 1—2 мин., 30 циклов). Все праймерные системы и зонды являются оригинальными и разработаны в ходе прове­дения данного исследования. Для гена BRAF праймеры были синтезированы для 15-го экзона: прямой прай­мер BRAF15D: gatctcttacctaaactcttca; обратный праймер BRAF15R: ccttcaatgactttctagtaact, для гена NRAS и KRAS праймеры были подобраны таким образом, чтобы ам- плифицировать 2, 3 и 4-й экзоны обоих генов: RAS1D: atgtggctcgccaattaacc и RAS1R tgggtaaagatgatccgacaa; RAS1: cccttaccctccacaccccc; RAS2 ctcatttccccataaagattcag; NRAS3x: ttcaagcagtctgccctcct; NRAS4: aactgatgcaaactcttgcaca; KRASD1: gatacacgtctgcagtcaac; KRASR1: tcctgcaccagtaatatgcat; KRASD2: ccagactgtgtttctcccttg; KRASR2: ttactccactgctctaatccc; KRAS3: gacaaaagttgtggacaggtt; KRAS4:ggacactggattaagaagcaa. Все ко­дирующие экзоны TP53, кроме 11-го, были включены в анализ и амплифицировались с использованием сле­дующих праймеров: TP53D1: gccgagctgtctcagacact; TP53R1: gaggaatcccaaagttccaaacaa; TP53D2: acg ccaactctctctagctc; TP53R2: ggccactgacaaccaccctta; TP53D3: ggcctcccctgcttgccaca; TP53R3: caaccacccttgtcctttct; TP53D4: ggcttctcctccacctacct; TP53R4: gcaggctaggctaagctatga; TP53D5: catgttgcttttgtaccgtca; TP53R5: cagctgcctttgaccatgaa.

Продукты ПЦР разделяли при помощи электрофо­реза в 6 % полиакриламидном геле (ПААГ) и визу­ализировали в УФ-свете после окрашивания броми­стым этидием. Для секвенирования ПЦР-продукты реакции очищали на колонках Wizard® SV Gel and PCR Clean-Up System Promega.

Праймеры синтезировали в ООО «Синтол». Секве- нирование проводили с помощью набора реактивов ABI PRISM®BigDyeTM Terminator v.3.1 с последую­щим анализом продуктов реакции на автоматическом секвенаторе ДНК ABI PRISM 3500 в ЦКП «Геном». Полученные с секвенатора электрофореграммы ана­лизировали в программе Vector NTI.

Результаты

Клиническое течение заболевания

Больной И. Ю. И., 1957 года рождения, наблюдал­ся в ФГБУ «НМИЦ гематологии» Минздрава России с мая 2013 г. с диагнозом ММ IIA ст. по Durie-Salmon, I ст. по ISS, I ст. по R-ISS. Диагноз был установлен в соответствии с критериями, разработанными Ме­ждународной рабочей группой по изучению ММ (The International Myeloma Working Group — IMWG) [35]. На момент диагностики заболевания был выполнен первый молекулярно-генетический скрининг (FISH, определение экспрессии и мутационный статус ге­нов). При проведении индукции ремиссии было вы­полнено пять курсов по программе PAD (бортезомиб + адриабластин + дексаметазон). После второго кур­са была достигнута частичная ремиссия (ЧР), а после пяти — очень хорошая частичная ремиссия (ОХЧР).

На фоне ОХЧР были выполнены мобилизация и сбор аутологичных стволовых клеток крови по схеме 4 г/м2 и гранулоцитарный колониестимулирующий фактор 5 мкг/кг. За две процедуры лейкафереза было заготов­лено 13,0 X 106/кг CD34+-клеток. В перерыве между сбо­ром аутологичных стволовых клеток крови и выполне­нием трансплантации аутологичных гемопоэтических стволовых клеток (ауто-ТГСК) с целью сдерживания достигнутого противоопухолевого ответа проведено четыре бортезомиб-содержащих курса (VCD: борте- зомиб + дексаметазон). По результатам обследования непосредственно перед ауто-ТГСК была констатирова­на полная строгая ремиссия заболевания (результаты иммунохимического исследования, данные костного мозга). Однако сохранялись остеодеструктивные очаги, замещенные содержимым жировой плотности. При об­следовании на +100-й день после ауто-ТГСК была кон­статирована прогрессия заболевания (В-симптомы, по данным иммунохимического исследования сыво­ротки крови и мочи помимо исходного парапротеина G-лямбда, впервые за весь период наблюдения была вы­явлена секреция парапротеина М-лямбда 5,3 г/л). Реин- дукционные бортезомиб-содержащие курсы оказались неэ фф ективными. Больной был переведен на вторую линию терапию иммуномодулирующими препаратами, на фоне которой удалось достичь лишь частичного про­тивоопухолевого ответа. Спустя четыре месяца от мо­мента констатации рецидива заболевания больной умер от тяжелых инфекционных осложнений.

Молекулярно-цитогенетическое исследование (FISH). При молекулярно-цитогенетическом ис­следовании (FISH) в дебюте заболевания был вы­явлен лишь гипердиплоидный тип ММ (трисомии 5, 9, 15) в 50 % ядер. При повторном цитогенетиче­ском исследовании на фоне прогрессии заболевания сохранялся гипердиплоидный тип ММ, однако по­явилась amp1q21 в 170 интерфазных ядрах из 200 исследованных, то есть в 85 % ядер. На рисунке 1 представлены результаты FISH-исследования мо- нонуклеаров костного мозга в дебюте заболевания, а на рисунке 2 — результаты FISH CD138+-клеток костного мозга в рецидиве ММ.

 

Рисунок 1. Результаты FISH-исследования мононуклеаров костного мозга в дебюте заболевания: А — гипердиплоидия (трисомии 5, 9, 15): три зеленых сигнала от локуса 5р 1 2, три голубых сигнала от локуса 9q22/NR4A3 и три красных сигнала от локуса 15q22/SMAD6; Б — амплификация локуса 1q21 не выявлена: два зеленых сигнала от локуса 1p32/CDKN2C и два красных сигнала от локуса 1q21/CKS1B

Figure 1. Results of FISH-analysis mononuclear cells bone marrow at diagnosis: А — hyperdiploidy (trisomies 5, 9, 15): three green signals of 5р12 locus, three blue signals of 9q22/NR4A3 locus и three red signals of 15q22/SMAD6 locus; Б — Amplification of locus 1q21 was not found: two green signals of 1p32/CDKN2C locus and two red signals of 1q21/CKS1B locus

 

 

Рисунок 2. Результаты FISH-исследования CD138+-клеток костного мозга в рецидиве заболевания: А — гипердиплоидия (трисомии 5, 9, 15): три зеленых сигнала от локуса 5р 1 2, три голубых сигнала от локуса 9q22/NR4A3 и три красных сигнала от локуса 15q22/SMAD6; Б — амплификация локуса 1q21: два зеленых сигнала от локуса 1p32/CDKN2C и четыре красных сигнала от локусс 1q21/CKS1B (два из них дополнительные)

Figure 2. Results of FISH-analysis CD138-positive cells bone marrow at the time of relapse: А — hyperdiploidy (trisomies 5, 9, 15): three green signals of 5р12 locus, three blue signals of 9q22/NR4A3 locus и three red signals of 15q22/SMAD6 locus; Б — Amplification of locus 1q21: two green signals of 1p32/CDKN2C locus and four red signals of 1q21/CKS1B locus (two of them are additional)

 

Анализ экспрессии генов с-MYC, MMSET, CCND1, CCND2, CKS1B, NOTCH2, IL-6, BCL2, TP53, MDM2. Анализ экспрессии гена с-MYC показал, что в реци­диве заболевания в плазматических клетках костного мозга больного незначительно повысилось количест­во мРНК с-MYC (в 1,5 раза по сравнению с моментом диагностики заболевания). Экспрессия с-MYC на мо­мент диагностики была в 4,4 раза выше, чем сред­нее значение, полученное в результате измерений для 10 доноров.

Значительноеувеличениеуровня экспрессии при раз­витии рецидива заболевания было выявлено для гена Notch2. Экспрессия Notch2 увеличилась в 3,2 раза, при­чем в дебюте заболевания она не превышала верхние показатели, полученные для доноров, но была выше усредненного значения. Наиболее заметное повыше­ние экспрессии наблюдалось для гена IL-6 в рециди­ве заболевания, его экспрессия увеличилась в 29 раз по сравнению с дебютом заболевания. Уже до нача­ла лечения значение экспрессии гена IL-6 было выше в три раза, чем среднее значение у доноров. Высокий уровень экспрессии гена MDM2 — репрессора р53 — был зарегистрирован в дебюте и при рецидиве заболе­вания, причем при рецидиве его количество возросло в 2,5 раза. Во время диагностики ММ его уровень был выше верхних показателей у доноров в два раза. Повы­шенное значение экспрессии в рецидиве по сравнению с дебютом заболевания можно также отметить у генов MMSET и CKS1B (в 3,5 и 1,8 раза соответственно). Зна­чительное снижение экспрессии во время прогрессии ММ было детектировано у генов CCND1 и CCND2. Од­нако ее значения находятся в диапазоне колебаний уровня экспрессии у доноров, и, вероятно, эти измене­ния не несут функциональной нагрузки. Экспрессия гена TP53 у больного не выходила за рамки значений, полученных для доноров (166 и 479 ngc соответствен­но) и существенно не изменилась в рецидиве по срав­нению с дебютом заболевания.

Отмечено снижение на порядок при рецидиве экс­прессии генов клональных иммуноглобулинов, характеризующих опухолевые клетки (IGHV3-33/IGHG2, IGLV1-44/IGLC2'), что соответствует выявленному при иммунохимическом исследовании уменьшению моноклональной секреции парапротеина G-лямбда с 23,8 до 5 ,4 г/л. В то же время экспрессия неклональ­ных иммуноглобулинов (в таблице 1 для примера при­ведены IGHV3-23 и IGHV2-5) снизилась почти на два порядка, что свидетельствует о наличии у больного с рецидивом заболевания глубокого иммунодефици­та. Полученные результаты анализа экспрессии генов представлены на рисунке 3 и в таблице 1.

 

Рисунок 3. Изменение экспрессии генов в дебюте ММ и при констатации рецидива у больного в сравнении со значениями экспрессии этих генов у доноров. По оси абсцисс расположены гены, по оси ординат — значения их экспрессии, выраженной в количестве прочтений гена, нормированное на общее число прочтений (normal­ized gene counts, ngc). Уровень экспрессии генов проанализирован в дебюте (синие окружности) и рецидиве (красные окружности) заболевания. Диапазон значений экспрессии данных генов у здоровых людей представлен в виде прямоугольников с перцентилями. Перцентили отображают разброс значений, где в верхнюю и в нижнюю перцентили попадает по 25 % краевых значений. Пересекающая прямоугольник линия — это медиана значений экспрессии для данного гена

Figure 3. Change in gene expression at the diagnosis of MM and at the time of relapse in comparison with the range expression of those genes in the group of donors. Axis X: genes, axis Y: gene expression values in normalized gene counts, ngc. Gene expression level (gene normalized counts) is analyzed at the diagnosis (blue circles) and at the time of relapse (red circles) of the patient with MM. Range of health people gene expression values are represented in the boxes with percentiles. The percentiles show the value below (lower percentiles) or above (upper percentiles) which 25 % of the observations may be found. The line which is crossing the box determines the median value of the expression of the gene

 

Мутационный статус генов N-RAS, K-RAS, BRAF и ТР53

Секвенирование экзонов 2, 3 и 4 генов N-RAS и K-RAS выявило у больного активирующую соматическую миссенс-мутацию с.182А> C в кодоне 61-го гена N-RAS (p.Q61P). В материале, взятом у больного во время рецидива, диагностированная ранее мутация в той же позиции сохранилась (рис. 4). Соотношение нор­мального и мутантного пиков на электрофореграмме, близкое к 1, свидетельствует о клональном характере данного нарушения.

 

Рисунок 4. Активирующая мутация гена N-RAS в кодоне 61. Фрагменты электрофореграмм 3-го экзона гена N-RAS, содержащие миссенс-мутацию (замена аденина на цитозин в 61-м кодоне): А — дебют заболевания; Б — рецидив заболевания

Figure 4. Activating mutation of N-RAS gene in 61st codon. Fragment of the sequence elecfrophoregram of N-RAS gene 3rd exon containing missence mutation (replacement of adenine by cytosine in 61 codon: A — disease debut; Б — disease relapse

 

При параллельном секвенировании ДНК и РНК гена N-RAS в клетках CD138+ опухоли в дебюте и рецидиве заболевания, электрофореграммы практически не отличались друг от друга (соотношение нормально­го и мутантного пиков 1:1), что свидетельствует об от­сутствии различий в экспрессии мутантного аллеля и аллеля «дикого типа».

Секвенирование экзона 15 гена BRAF, в котором обычно локализуются активирующие соматические мутации, в том числе наиболее распространенная p.V600E, показало отсутствие каких-либо отклонений от референсной последовательности как в первичном, так и в рецидивном материале.

Была проанализирована также первичная структу­ра всех функционально важных областей гена TP53 в материале опухоли как при диагностике ММ, так и при рецидиве заболевания. Соматических мутаций найдено не было. Выявлен только полиморфный вари­ант (p.P72R, rs1042522 в базе данных NCBI/SNP) в ге­терозиготном состоянии, не имеющий функциональ­ного значения [36].

Обсуждение

В работе был сопоставлен молекулярно-генети­ческий статус опухолевых клеток у больного ММ в дебюте и при рецидиве заболевания. Исходно про­тивоопухолевый ответ на индукционную терапию бортезомиб-содержащими курсами расценивался как полная иммунохимическая ремиссия, однако при рецидиве заболевания была констатирована рези­стентность к терапии бортезомибом. Рецидив заболе­вания сопровождался не только сохранением прежне­го клонального парапротеина IgG-λ, но и появлением не выявлявшегося ранее парапротеина IgM-λ. Имму- нохимический рецидив характеризовался появлением симптомокомплекса CRAB: включающего гиперкаль- циемию (Calcium), почечную недостаточность (Renal failure), анемию (Anemia) и остеолитическое пораже­ние костей (Bone lesions). Больной умер в результа­те инфекционных осложнений через четыре месяца от момента диагностики прогрессии заболевания.

При молекулярно-цитогенетическом исследовании в дебюте и при рецидиве заболевания была выявлена трисомия хромосом 5, 9 и 15. Гипердиплоидия при ММ ассоциируется с благоприятным прогнозом и лучшей выживаемостью больных [37].

На фоне прогрессии ММ у больного возникла но­вая цитогенетическая аберрация — амплификация локуса хромосомы 1 (amp1q21). Анализ экспрессии гена CKS1B, расположенного в этом локусе, показал ее возрастание при рецидиве примерно в два раза по сравнению с дебютом заболевания, что согласу­ется с увеличением его копийности. Данная хро­мосомная аномалия считается фактором плохого прогноза. Отчасти это может быть связано с увели­чением числа копий гена CKS1B и усилением его экспрессии, которое может влиять на общую и без- рецидивную выживаемость, а также резистентность к бортезомиб-содержащим курсам [38]. Показано [39] также, что amp1q21 значительно реже встречает­ся при МГНГ, чем при ММ, и может способствовать прогрессии заболевания, однако авторы этой работы пришли к выводу о том, что уровень экспрессии гена CKS1B на этот процесс не влияет, и он обусловлен, скорее всего, генетической нестабильностью длинно­го плеча хромосомы 1 как таковой.

Анализ транскриптомных данных  показал, что при рецидиве в сравнении с дебютом заболева­ния повышена экспрессия генов с-MYC, Notch2, MDM2 и IL-6. Однако, если экспрессия первых трех генов повысилась всего в 1,5—3 раза, количество транскрип­та гена IL-6 возросло почти в 30 раз. Не исключено, что именно резкое усиление экспрессии этого цитоки- на послужило пусковым механизмом прогрессии ММ у больного, поскольку IL-6 стимулирует клеточную пролиферацию, активируя различные сигнальные пути (MAPK, JAK-STAT, PI3K) [1, 40].

При рецидиве внутри каждого из этих путей наблю­далось повышение экспрессии по крайней мере одного гена регуляторного белка (RAF1, STAT4 и mTOR соот­ветственно). В свою очередь, индукция IL-6 может, по крайней мере отчасти, объясняться усилением экс­прессии гена Notch2 (в 3,3 раза по сравнению с дебю­том заболевания). Notch2 активирует экспрессию IL-6 в клетках костномозговых ниш (клетках стромы) и плазматических клетках костного мозга. Показано, что IL6 является одним из ключевых факторов, влия­ющих на жизнеспособность и неконтролируемое деле­ние миеломных клеток [30].

Экспрессия гена транскрипционного фактора с-MYC повысилась при рецидиве заболевания незначитель­но, всего в 1,5 раза, однако, как и в дебюте заболева­ния, была на существенно более высоком уровне, чем у доноров. Механизм повышенной экспрессии в дан­ном случае остается не ясен, так как при FISH-иссле­довании ни транслокации с вовлечением локуса гена с-MYC, ни трисомия 8 не были выявлены. Возможно, имеет место эпигенетическая регуляция гена с-MYC. Клетки, конститутивно экспрессирующие высокий уровень с-MYC, обладают пониженной зависимостью от ростовых факторов и большей скоростью пролифе­рации. Таким образом, повышенный уровень с-MYC также мог быть одним из факторов, спровоцировав­ших прогрессию ММ.

Экспрессия гена TP53 при рецидиве существенно не изменилась, оставаясь в пределах диапазона значе­ний экспрессии гена TP53 у доноров (табл. 1), и ника­ких мутаций в нем выявлено не было. При этом экс­прессия гена белка mdm2, являющегося ингибитором ТР53, увеличилась в 2,5 раза, что вполне могло повлечь за собой ослабление функции ТР53 при прогрессии за­болевания.

Резкое снижение экспрессии всех генов иммуногло­булинов, в том числе и клональных, соответствующих парапротеину G-лямбда, свидетельствовало о нали­чии глубокого иммунодефицита при прогрессии ММ.

В дебюте заболевания больной не относился к группе высокого риска по клиническим и цитогенетическим данным, однако у него была выявлена клональная ге­терозиготная мутация p.Q61P в гене N-RAS, благода­ря которой происходит неконтролируемая активация сигнального пути MAPK, ведущая к повышению про­лиферативного потенциала опухолевых клеток. После проведения курсов терапии при рецидиве заболевания мутация сохранилась в клональном состоянии. Вли­яние активирующих мутаций в генах семейства RAS на патогенез ММ исследуется давно и достаточно ак­тивно, однако результаты опубликованных работ при­водят к противоречивым выводам об их значимости. В исследовании, посвященном изучению дифференци­альной экспрессии мутантного и нормального аллелей [11], было показано, что мутантный аллель экспресси­руется слабее аллеля «дикого типа». У наблюдавшего­ся больного нормальная и мутантная копии гена N-RAS в дебюте и рецидиве ММ экспрессировались с оди­наковой эффективностью. Оба варианта белка могли играть существенную роль в активации сигнального МАРК-пути при прогрессии заболевания: мутантный белок — за счет потери контроля над ним со стороны цитокинов, нормальный белок — вследствие стимуля­ции гиперэкспрессией IL-6.

Таким образом, можно сделать вывод о том, что при ММ целесообразно выполнять комплексную молекулярную диагностику, включающую развернутое цитогенетиче­ское исследование, анализ экспрессии и мутационный анализ широкого спектра генов регуляторных белков, так как единичная хромосомная или генная аномалия вряд ли может сама по себе служить определяющим фактором прогноза развития заболевания и его рези­стентности к применяемой терапии.

Список литературы

1. Prideaux S.M., Conway O’Brien E., Chevassut T.J. The genetic architecture of multiple myeloma. Adv. Hematol. 2014; 864058. DOI: 10.1155/2014/864058

2. Fonseca R., Barlogie B., Bataille R. et al. Genetics and cytogenetics of multiple myeloma: A workshop report. Cancer Res. 2004; 64: 1546–58.

3. Maura F., Degasperi A., Nadeu F. et al. A practical guide for mutational signature analysis in hematological malignancies. Nat Commun. 2019; 10(1): 2969. DOI: 10.1038/s41467-019-11037-8

4. Bolli N., Biancon G., Moarii M. et al. Analysis of the genomic landscape of multiple myeloma highlights novel prognostic markers and disease subgroups. Leukemia. 2018; 32(12): 2604–16. DOI: 10.1038/s41375-018-0037-9

5. Bolli N., Avet-Loiseau H., Wedge D.C. et al. Heterogeneity of genomic evolution and mutational profi les in multiple myeloma. Nat Commun. 2014; 5: 2997. DOI: 10.1038/ncomms3997

6. Szalat R., Avet-Loiseau H., Munshi N.C. Gene Expression Profi les in Myeloma: Ready for the Real World? Clin Cancer Res. 2016; 22(22): 5434–42. DOI: 10.1158/1078-0432.CCR-16-0867

7. Chng W.J., Gonzalez-Paz N., Price-Troska T. et al. Clinical and biological signifi cance of RAS mutations in multiple myeloma. Leukemia. 2008; 22: 2280–4. DOI: 10.1038/leu.2008.142

8. Pylayeva-Gupta Y., Grabocka E., Bar-Sagi D. RAS oncogenes: weaving a tumorigenic web. Nat Rev Cancer. 2011; 11: 761–74.

9. Rasmussen T., Kuehl M., Lodahl M. et al. Possible roles for activating RAS mutations in the MGUS to MM transition and in the intramedullary to extramedullary transition in some plasma cell tumors. Blood. 2005; 105(1): 317–23.

10. Kim S.J., Shin H.T., Lee H.O. et al. Recurrent mutations of MAPK pathway genes in multiple myeloma but not in amyloid light-chain amyloidosis. Oncotarget. 2016; 7(42): 68350–9. DOI: 10.18632/oncotarget.12029

11. Rashid N.U., Sperling A.S., Bolli N. et al. Differential and limited expression of mutant alleles in multiple myeloma. Blood. 2014; 124: 3110–7.

12. Hu Y., Chen E., Wang J. Progress in the identifi cation of gene mutations involved in multiple myeloma. Onco Targets Ther. 2019; 12: 4075–80. DOI: 10.2147/OTT.S205922

13. Andrulis M., Lehners N., Capper D. et al. Targeting the BRAF V600E mutation in multiple myeloma. Cancer Discov. 2013; 3: 862–9. DOI: 10.1158/2159-8290. CD-13-0014

14. Levine A.J. p53, the Cellular Gatekeeper for Growth and Division. Cell. 1997; 88: 323–31.

15. Salmon S.E., Dalton W.S., Grogan T.M. et al. Multidrug-resistant myeloma: laboratory and clinical effects of verapamil as a chemosensitizer. Blood. 1991; 78: 44–50.

16. Brooks T.A., Hurley L.H. Targeting MYC Expression through G-Quadruplexes. Genes Cancer. 2010; 1(6): 641–9.

17. Dang C.V. MYC on the path to cancer. Cell. 2012; 149(1): 22–35. DOI: 10.1016/j.cell.2012.03.003

18. Gao P., Tchernyshyov I, Chang T.C. et al. c-myc suppression of miR-23a/b enhances mitochondrial glutaminase expression and glutamine metabolism. Nature. 2009; 458(7239): 762–5. DOI: 10.1038/nature07823

19. Kuzyk A., Mai S. c-MYC-induced genomic instability. Cold Spring Harb Perspect Med. 2014; 4(4): a014373. DOI: 10.1101/cshperspect.a014373

20. Karlsson A., Giuriato S., Tang F. et al. Genomically complex lymphomas undergo sustained tumor regression upon MYC inactivation unless they acquire novel chromosomal translocations. Blood. 2003; 101(7): 2797–803.

21. Mirabella F., Wu P., Wardell C.P. et al. MMSET is the key molecular target in t(4;14) myeloma. Blood Cancer J. 2013; 3(5): 114. DOI: 10.1038/bcj.2013.9

22. Chesi M., Bergsagel P.L. Molecular pathogenesis of multiple myeloma: basic and clinical updates. Int J Hematol. 2013; 97(3): 313–23. DOI: 10.1007/s12185-013-1291-2

23. Zhan F., Colla S., Wu X. et al. CKS1B, overexpressed in aggressive disease, regulates multiple myeloma growth and survival through SKP2- and p27Kip1- dependent and -independent mechanisms. Blood. 2007; 109(11): 4995–5001.

24. Smol T., Dufour A., Tricot S. et al. Combination of t(4;14), del(17p13), del(1p32) and 1q21 gain FISH probes identifi es clonal heterogeneity and enhances the detection of adverse cytogenetic profi les in 233 newly diagnosed multiple myeloma. Mol Cytogenet. 2017; 10: 26. DOI: 10.1186/s13039-017-0327-3

25. Lobry C., Oh P., Mansour M.R. et al. Notch signaling: switching an oncogene to a tumor suppressor. Blood. 2014; 123(16): 2451–9. DOI: 10.1182/blood-2013-08-355818

26. Colombo M., Mirandola L., Platonova N. et al. Notch-directed microenvironment reprogramming in myeloma: a single path to multiple outcomes. Leukemia. 2013; 27(5): 1009–18. DOI: 10.1038/leu.2013.6

27. Colombo M., Galletti S., Bulfamante G. et al. Multiple myeloma-derived Jagged ligands increases autocrine and paracrine interleukin-6expression in bone marrow niche. Oncotarget. 2016; 7(35): 56013–29. DOI: 10.18632/oncotarget.10820

28. Kishimoto T. The biology of interleukin-6. Blood 1989; 74: 1–10.

29. Frassanito M.A., Cusmai A., Iodice G., Dammacco F. Autocrine interleukin-6 production and highly malignant multiple myeloma: relation with resistance to drug-induced apoptosis. Blood. 2001; 97(2):483–9.

30. Gadó K., Domján G., Hegyesi H., Falus A. Role of interleukin-6 in the pathogenesis of multiple myeloma. Cell Biol Int. 2000; 24(4): 195–209.

31. Herrero A.B., Rojas E.A., Misiewicz-Krzeminska I. et al. Molecular Mechanisms of p53 Deregulation in Cancer: An Overview in Multiple Myeloma. Int J Mol Sci. 2016; 17(12): 2003. DOI:10.3390/ijms17122003

32. Simons A., Shaffer L.G., Hastings R.J. Cytogenetic Nomenclature: Changes in the ISCN 2013 Compared to the 2009 Edition. Cytogenet. Genome Res 2013; 141: 1–6. DOI: 10.1159/000353118

33. Dobin A., Davis C.A., Schlesinger F. et al. STAR: ultrafast universal RNA-seqaligner. Bioinformatics. 2013; 29(1): 15–21. DOI: 10.1093/bioinformatics/bts635

34. Love M.I., Huber W., Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014; 15(12): 550.

35. Rajkumar S.V., Dimopoulos M.A., Palumbo A. et al. International Myeloma Working Group updated criteria for the diagnosis of multiple myeloma. Lancet Oncol. 2014; 15(12): 538–48. DOI: 10.1016/S1470-2045(14)70442-5

36. Kodal J., Vedel-Krogh S., Kobylecki C. et al. TP53 Arg72Pro, mortality after cancer, and all-cause mortality in 105,200 individuals. Sci Rep. 2017; 7: 336. DOI: 10.1038/s41598-017-00427-x

37. Smadja N.V., Bastard C., Brigaudeau C. et al. Hypodiploidy is a major prognostic factor in multiple myeloma. Blood. 2001; 98(7): 2229–38.

38. Chen M.H., Qi C., Reece D., Chang H. Cyclin kinase subunit 1B nuclear expression predicts an adverse outcome for patients with relapsed/refractory multiple myeloma treated with bortezomib. Hum Pathol. 2012; 43(6): 858–64. DOI: 10.1016/j.humpath.2011.07.013

39. Stella F.,Pedrazzini E., Baialardo E. et al. Quantitative analysis of CKS1B mRNA expression and copy number gain in patients with plasma cell disorders. Blood Cells Mol Dis. 2014; 53(3): 110–7. DOI: 10.1016/j.bcmd.2014.05.006

40. Chauhan D., Uchiyama H., Akbarali Y. et al. Multiple myeloma cell adhesioninduced interleukin-6 expression in bone marrow stromal cells involves activation of NF-kappa B. Blood. 1996; 87(3): 1104–12.


Об авторах

А. М. Сергеева
ФГБУ «Национальный медицинский исследовательский центр гематологии» Министерства здравоохранения Российской Федерации
Россия

научный сотрудник лаборатории генной инженерии,

125167, г. Москва, Новый Зыковский проезд, 4



Т. В. Абрамова
ФГБУ «Национальный медицинский исследовательский центр гематологии» Министерства здравоохранения Российской Федерации
Россия

кандидат медицинских наук, врач клинической лабораторной диагностики лаборатории кариологии,

125167, Москва



В. Л. Сурин
ФГБУ «Национальный медицинский исследовательский центр гематологии» Министерства здравоохранения Российской Федерации
Россия

старший научный сотрудник лаборатории генной инженерии,

125167, Москва



Т. Н. Обухова
ФГБУ «Национальный медицинский исследовательский центр гематологии» Министерства здравоохранения Российской Федерации
Россия

кандидат медицинских наук, заведующая лабораторией кариологии,

125167, Москва



М. В. Довыденко
ФГБУ «Национальный медицинский исследовательский центр гематологии» Министерства здравоохранения Российской Федерации
Россия

кандидат медицинских наук, врач-гематолог отделения интенсивной высокодозной химиотерапии и трансплантации костного мозга с круглосуточным стационаром,

125167, Москва



М. В. Сунцова
ФГБУН «Институт биоорганической химии им. академиков М.М. Шемякина и Ю.А. Овчинникова» Российской академии наук; ФГБУ «Федеральный научно-клинический центр детской гематологии, онкологии и иммунологии им. Дмитрия Рогачева» Министерства здравоохранения Российской Федерации
Россия

младший научный сотрудник лаборатории геномного анализа сигнальных систем клетки,

117198, Москва;

117997, Москва



А. А. Буздин
ФГБУ «Федеральный научно-клинический центр детской гематологии, онкологии и иммунологии им. Дмитрия Рогачева» Министерства здравоохранения Российской Федерации; ФГАОУ ВО «Первый Московский государственный медицинский университет им. И.М. Сеченова» (Сеченовский университет) Министерства здравоохранения Российской Федерации
Россия

доктор медицинских наук, профессор, заведующий лабораторией клинической и геномной биоинформатики,

117997, Москва;

119991, Москва



Л. П. Менделеева
ФГБУ «Национальный медицинский исследовательский центр гематологии» Министерства здравоохранения Российской Федерации
Россия

доктор медицинских наук, профессор, заведующая отделением высокодозной химиотерапии парапротеинемических гемобластозов,

125167, Москва



Для цитирования:


Сергеева А.М., Абрамова Т.В., Сурин В.Л., Обухова Т.Н., Довыденко М.В., Сунцова М.В., Буздин А.А., Менделеева Л.П. СРАВНЕНИЕ МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКОЙ СТРУКТУРЫ ОПУХОЛЕВЫХ КЛЕТОК ДО ЛЕЧЕНИЯ И ПОСЛЕ КОНСТАТАЦИИ РЕЦИДИВА МНОЖЕСТВЕННОЙ МИЕЛОМЫ (КРАТКИЙ ОБЗОР И ОПИСАНИЕ КЛИНИЧЕСКОГО СЛУЧАЯ). Гематология и трансфузиология. 2019;64(3):362-374. https://doi.org/10.35754/0234-5730-2019-64-3-362-374

For citation:


Sergeeva A.M., Abramova T.V., Surin V.L., Obukhova T.N., Dovydenko M.V., Suntsova M.V., Buzdin A.A., Mendeleeva L.P. MOLECULAR GENETIC STRUCTURE OF MULTIPLE MYELOMA TUMOUR CELLS PRIOR TO TREATMENT AND AT THE TIME OF RELAPSE: SHORT REVIEW AND CASE REPORT. Russian journal of hematology and transfusiology. 2019;64(3):362-374. (In Russ.) https://doi.org/10.35754/0234-5730-2019-64-3-362-374

Просмотров: 465


Creative Commons License
Контент доступен под лицензией Creative Commons Attribution 4.0 License.


ISSN 0234-5730 (Print)
ISSN 2411-3042 (Online)